🎓 Biology • Molecular Biology
100% Client-Side Privacy
DNA Reverse Complement Calculator
Generates reverse complement DNA sequences in standard 5' to 3' direction, essential for PCR primer design and molecular cloning.
⭐ Classic Molecular Biology Presets:
5' ⟶ 3' Nucleotide Sequence Input (DNA or RNA)
Paste raw sequence or FASTA header format. Automatically removes numbers and whitespace.
27 bp
Bases:A: 7T/U: 4G: 8C: 8GC: 59.3% | AT: 40.7%
GC Content59.3%G+C = 16 nt
Melting Temp (Tm)64.3°CSalt-Adjusted (50mM Na⁺)
ssDNA Mol Weight8,294g/mol (Daltons)
dsDNA Weight17,820Average 660 Da/bp
Antiparallel Watson-Crick Double Helix Base-Pairing DiagramShowing first 14 base pairs
Adenine (A) Thymine (T) Guanine (G) Cytosine (C)A=T (2 H-Bonds) | G≡C (3 H-Bonds)
5' ⟶ 3' Reverse Complement (Standard PCR Primer Orientation):Inverted 5' to 3' sequence for ordering oligonucleotides and primers
5' - CTACAGTGTTCTGGGCGCCATGGCCAT - 3'
Forward Primer (5' ⟶ 3')ATGGCCATGGCGCCCAGAAC...
Reverse Primer (5' ⟶ 3')CTACAGTGTTCTGGGCGCCA...
What is a Reverse Complement?
Because DNA strands run antiparallel (5' to 3' opposite 3' to 5'), the reverse complement represents the sequence of the opposing strand read in standard 5' to 3' orientation.
Formula & Step-by-Step Calculation
5'-ATCG-3' ⟹ Complement: 3'-TAGC-5' ⟹ Reverse Complement: 5'-CGAT-3'
Complement each base then reverse the order.
Worked Step-by-Step Examples
Example 1
Reverse complement of 5'-ATGGCCATG-3'
Solution: 5'-CATGGCCAT-3'
• Complement: TACCGGTAC; Reverse: CATGGCCAT
Common Real-World & Academic Use Cases
- ✓ PCR reverse primer design
- ✓ Sanger sequencing read alignment
- ✓ CRISPR gRNA target strand verification
How to Use the DNA Reverse Complement Calculator
1
Enter DNA Sequence
Paste 5' to 3' sequence.
2
Copy Reverse Complement
Click to copy ready-to-order PCR primer.
Frequently Asked Questions
Q: Why do PCR reverse primers need to be reverse complemented?
Because DNA polymerases synthesize DNA exclusively in the 5' to 3' direction.