🎓 Biology • Molecular Biology
100% Client-Side Privacy
DNA Complement Calculator
Generates the complementary antiparallel DNA strand according to Watson-Crick base pairing (A-T, C-G).
⭐ Classic Molecular Biology Presets:
5' ⟶ 3' Nucleotide Sequence Input (DNA or RNA)
Paste raw sequence or FASTA header format. Automatically removes numbers and whitespace.
27 bp
Bases:A: 7T/U: 4G: 8C: 8GC: 59.3% | AT: 40.7%
GC Content59.3%G+C = 16 nt
Melting Temp (Tm)64.3°CSalt-Adjusted (50mM Na⁺)
ssDNA Mol Weight8,294g/mol (Daltons)
dsDNA Weight17,820Average 660 Da/bp
Antiparallel Watson-Crick Double Helix Base-Pairing DiagramShowing first 14 base pairs
Adenine (A) Thymine (T) Guanine (G) Cytosine (C)A=T (2 H-Bonds) | G≡C (3 H-Bonds)
5' ⟶ 3' Direct Watson-Crick Complement Strand:
5' - TACCGGTACCGCGGGTCTTGTGACATC - 3'
Antiparallel Alignment:
Sense (5' ⟶ 3'): ATGGCCATGGCGCCCAGAACACTGTAG
Anti (3' ⟵ 5'): TACCGGTACCGCGGGTCTTGTGACATC
What is DNA Complementarity?
DNA complementarity is the biochemical property where Adenine specifically hydrogen bonds with Thymine (2 bonds), and Cytosine bonds with Guanine (3 bonds).
Formula & Step-by-Step Calculation
A ⟷ T, C ⟷ G (Watson-Crick base pairing)
Antiparallel complementary nucleotide pairing.
Worked Step-by-Step Examples
Example 1
Find complement of 5'-ATGGCC-3'
Solution: 5'-GGCCAT-3' (or 3'-TACCGG-5')
• A->T, T->A, G->C, G->C, C->G, C->G
Common Real-World & Academic Use Cases
- ✓ Double helix model construction
- ✓ Southern blot hybridization probe design
- ✓ Oligonucleotide synthesis checks
How to Use the DNA Complement Calculator
1
Paste DNA Sequence
Enter nucleotides (A, T, C, G).
2
View Complement
Inspect complementary sequence and GC percentage.
Frequently Asked Questions
Q: Why is GC content important?
G-C pairs have 3 hydrogen bonds compared to 2 in A-T pairs, giving higher thermal melting stability (Tm).