🎓 Biology • Molecular Biology
100% Client-Side Privacy
DNA to RNA Transcription Converter
Converts DNA sequences into transcribed messenger RNA (mRNA) by replacing Thymine with Uracil, and vice-versa.
⭐ Classic Molecular Biology Presets:
5' ⟶ 3' Nucleotide Sequence Input (DNA or RNA)
Paste raw sequence or FASTA header format. Automatically removes numbers and whitespace.
27 bp
Bases:A: 7T/U: 4G: 8C: 8GC: 59.3% | AT: 40.7%
GC Content59.3%G+C = 16 nt
Melting Temp (Tm)64.3°CSalt-Adjusted (50mM Na⁺)
ssDNA Mol Weight8,294g/mol (Daltons)
dsDNA Weight17,820Average 660 Da/bp
Antiparallel Watson-Crick Double Helix Base-Pairing DiagramShowing first 14 base pairs
Adenine (A) Thymine (T) Guanine (G) Cytosine (C)A=T (2 H-Bonds) | G≡C (3 H-Bonds)
Transcribed mRNA Molecule (5' ⟶ 3'):
5' - AUGGCCAUGGCGCCCAGAACACUGUAG - 3'
Coding DNA Strand (5' ⟶ 3')
ATGGCCATGGCGCCCAGAACACTGTAG
*Identical to mRNA, except T replaces UTemplate DNA Strand (3' ⟶ 5')
TACCGGTACCGCGGGTCTTGTGACATC
*RNA Polymerase reads this 3' to 5'What is RNA Transcription?
Transcription is the molecular process where RNA polymerase synthesizes a complementary single-stranded mRNA molecule from a DNA template strand.
Formula & Step-by-Step Calculation
Thymine (T) in DNA ⟶ Uracil (U) in RNA
Uracil lacks the methyl group present on thymine.
Worked Step-by-Step Examples
Example 1
Transcribe DNA: 5'-ATGGCT-3'
Solution: mRNA: 5'-AUGGCU-3'
• Replace all T with U
Common Real-World & Academic Use Cases
- ✓ mRNA vaccine design & in vitro transcription
- ✓ RT-PCR cDNA conversion
- ✓ Northern blot transcript analysis
How to Use the DNA to RNA Transcription Converter
1
Paste DNA Sequence
Enter nucleotide string.
2
View Transcribed RNA
Inspect resulting mRNA sequence.
Frequently Asked Questions
Q: Why does RNA use Uracil instead of Thymine?
Uracil is energetically less costly for cells to synthesize, though thymine provides higher fidelity in stable genomic DNA.